{"doi":"10.1111/cea.14289","title":"Association of a SYK promoter polymorphism with SYK expression and IgE‐mediated histamine release","abstract":"For 50 years, there has been a recognition that the in vitro IgE-mediated histamine release response of peripheral blood human basophils is broadly heterogeneous in the general population. It is a behaviour of these cells, with caveats (see below), that is, relatively stable for an individual. Over the last few decades, the intrinsic elements that underlie the mechanistic reasons for variability in this response have been explored and a consistent finding is that the expression level of the tyrosine kinase SYK explains a significant portion of the variability.1, 2 In more recent years, the basis for the variable SYK expression has also been explored and it is notable that despite the absolute dependence of human basophil IgE-mediated responsiveness on SYK activity, the average SYK expression in human basophils is 10–30 fold lower than other circulating leucocytes.3 SYK expression in human basophils lies on the cusp of providing IgE-mediated functionality. It has been recognized for some time that 10–20% of subjects have circulating basophils that are consistently poorly responsive to IgE-mediated stimulation.1, 2 In a recent report,4 the authors discovered a mutation in the promoter of the SYK gene that determines mRNA levels in 44 different human tissues. Whether this same mutation was associated with levels of SYK in human basophils was not explored at the time. We present evidence here that, in fact, the homozygous recessive mutation does associate with lower SYK expression levels in human basophils. A study of 59 individuals included three determinations: (1) an assay for the SNP that was previously identified (see below), (2) the level of SYK expression in basophils as determined by an established flow cytometric method and (3) the maximum IgE-mediated histamine release following stimulation with anti-IgE antibody. The SNP that was measured was one of 3 that were previously identified to be in 100% linkage disequilibrium (LD). Rs290988 was chosen for measurement because the other two associated SNPs (rs290987 and rs2562397) were located in high GC-rich regions that were more difficult to assess with the assay used. A custom TaqMan™ SNP genotyping assay was designed for the rs290988 variant in the SYK gene (forward primer: GCCTCATGGTCAGAACATATTTATAGACAAA, reverse primer: GCCAACCTGTAACCAATCCAGTT; probe 1 (VIC): CTTACCTCCAATTTC, probe 2 (FAM): TTACCTGCAATTTC). Genotyping was performed using the above mentioned TaqMan® probe-based, 5′ nuclease allelic discrimination assay on the QuantStudio™ 12 K Flex Real-Time PCR System (Applied Biosystems™, Foster City, CA) and the manufacturer's instructions were followed. SYK expression by flow cytometry (and in some cases by Western blotting to re-validate the flow results, data not presented) and IgE-mediated histamine release were measured using reported methodologies.2, 3 Statistical analysis was carried out in JMP, MedCalc Statistical Software version 18.11.3 (MedCalc Software, Ostend, Belgium) and PLINK 1.9. The full dataset can be found at www.basophil.net. Figure 1 summarizes the results of this profiling. Since the previous in silico analysis of these three SNPs showed only significantly reduced expression of SYK mRNA in the CC genotype,4 Figure 1 highlights the subjects with the CC genotype in red. In panel A, it can be seen that there is a significantly lower level of SYK expression in the subjects with the CC genotype (average difference in the two groups was 48 flow units, p = .0288, unpaired t-test). Several published studies (examples being1, 2) have shown the association between SYK expression and IgE-mediated histamine release. Therefore, it would be expected that histamine release in the CC subject group would also be poor. Figure 1B shows that this is also true (average difference in the two groups was 26% histamine release, p = .0014). Figure 2A–C present the results for each genotype. Figure 2D examines the statistical association of the CC genotype with poor release","journal":"Clinical & Experimental Allergy","year":2023,"id":372117,"datarank":0.0,"base_score":0.0,"endowment":0.0,"self_citation_contribution":0.0,"citation_network_contribution":0.0,"self_endowment_contribution":0.0,"citer_contribution":0.0,"corpus_percentile":null,"corpus_rank":null,"citation_count":5,"citer_count":0,"citers_with_citation_signal":0,"citers_with_endowment":0,"datacite_reuse_total":0,"is_dataset":false,"is_dataset_confidence":0.9393,"is_data_producer":false,"deposit_databanks":null,"is_oa":true,"file_count":0,"downloads":0,"has_version_chain":false,"published_date":"2023-01-01","fair_score":null,"fair_percentile":null,"algorithm_id":"datarank_citation_only_1hop_v6","ranking_scope":"data_only","authors":[{"id":297466,"name":"Li Gao","orcid":"0000-0001-6470-5905","position":1,"is_corresponding":false},{"id":495691,"name":"Donald W. MacGlashan","orcid":"0000-0003-4525-0452","position":0,"is_corresponding":true}],"reference_count":9,"raw_metadata":null,"created_at":"2026-07-19T01:15:54.000926Z","pmid":"36722389","pmcid":null,"fwci":null,"citation_percentile":null,"influential_citations":0,"oa_status":null,"license":null,"views":0,"total_file_size_bytes":0,"version_count":0,"fair_f":null,"fair_a":null,"fair_i":null,"fair_r":null,"fair_zscore":null,"fair_rationale":null,"fair_model":null,"fair_agent_version":null,"fair_fulltext_source":null,"fair_has_llm":null,"fair_computed_at":null,"clinical_trials":[],"software_tools":[],"db_accessions":[],"linked_datasets":[],"topics":[]}